Stem-loop sequence mdo-mir-27a

AccessionMI0005364 (change log)
DescriptionMonodelphis domestica miR-27a stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   u   uu a     a         ug cu        g   cag 
5'  ggc  g ggagc ggacuuagc  c  ugugaaca agu   c
    |||  | ||||| |||||||||  |  |||||||| |||   a
3'  ccg  c ccucg cuugaaucg  g  acacuugu uua   u
   -   uu c     c         gu --        g   uac 
Get sequence
Deep sequencing
233491 reads, 3.28e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 446525995-446526080 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-27a
mdo-mir-23achr3: 446525826-446525898 [+]
mdo-mir-27achr3: 446525995-446526080 [+]
mdo-mir-24-2chr3: 446526144-446526216 [+]
Database links

Mature sequence mdo-miR-27a-5p

Accession MIMAT0026711
Sequence

14 - 

aggacuuagcugccuugugaaca

 - 36

Get sequence
Deep sequencing566 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-27a-3p

Accession MIMAT0004174
Sequence

56 - 

uucacaguggcuaaguuccgc

 - 76

Get sequence
Deep sequencing232923 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).