Stem-loop sequence mdo-mir-23a

AccessionMI0005363 (change log)
DescriptionMonodelphis domestica miR-23a stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   ------   c     -       g    g      auua 
5'       cgg ugggg uuccugg gaug gauuug    c
         ||| ||||| ||||||| |||| ||||||     
3'       guc accuu agggacc uuac cuaaac    u
   ucacca   a     u       g    a      accg 
Get sequence
Deep sequencing
70035 reads, 840 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 446525826-446525898 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-23a
mdo-mir-23achr3: 446525826-446525898 [+]
mdo-mir-27achr3: 446525995-446526080 [+]
mdo-mir-24-2chr3: 446526144-446526216 [+]
Database links

Mature sequence mdo-miR-23a-5p

Accession MIMAT0026710
Sequence

8 - 

gguuccuggggaugggauuu

 - 27

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-23a-3p

Accession MIMAT0004173
Sequence

42 - 

aucacauugccagggauuuc

 - 61

Get sequence
Deep sequencing70026 reads, 5 experiments
Evidence experimental; PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).