Stem-loop sequence mdo-mir-19b-1

AccessionMI0005358 (change log)
DescriptionMonodelphis domestica miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   g    guu                 -  -      uc    uguau 
5'  cacu   cuaugguuaguuuugca gg uuugca  cagc     g
    ||||   ||||||||||||||||| || ||||||  ||||     a
3'  gugg   ggugucagucaaaacgu cc aaacgu  gucg     u
   g    --u                 a  u      --    ucuua 
Get sequence
Deep sequencing
6607 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 108468305-108468393 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-19b-1
mdo-mir-17chr7: 108468894-108468978 [-]
mdo-mir-18achr7: 108468760-108468831 [-]
mdo-mir-19achr7: 108468609-108468689 [-]
mdo-mir-20achr7: 108468430-108468531 [-]
mdo-mir-19b-1chr7: 108468305-108468393 [-]
mdo-mir-92a-1chr7: 108468191-108468268 [-]
Database links

Mature sequence mdo-miR-19b-1-5p

Accession MIMAT0026708
Sequence

17 - 

aguuuugcagguuugcauccagc

 - 39

Get sequence
Deep sequencing100 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-19b-3p

Accession MIMAT0004170
Sequence

55 - 

ugugcaaauccaugcaaaacuga

 - 77

Get sequence
Deep sequencing12967 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).