Stem-loop sequence mdo-mir-20a

AccessionMI0005357 (change log)
DescriptionMonodelphis domestica miR-20a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ugaa  ---g      uuu    c   -a                 g   -  uu 
5'     ag    acagcu   guag acu  aagugcuuauagugcag uag ug  u
       ||    ||||||   |||| |||  ||||||||||||||||| ||| ||   
3'     uc    ugucga   cguc uga  uucacgaguauuacguc auc au  a
   --ca  aaga      --u    a   ag                 -   u  ug 
Get sequence
Deep sequencing
23088 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 108468430-108468531 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-20a
mdo-mir-17chr7: 108468894-108468978 [-]
mdo-mir-18achr7: 108468760-108468831 [-]
mdo-mir-19achr7: 108468609-108468689 [-]
mdo-mir-20achr7: 108468430-108468531 [-]
mdo-mir-19b-1chr7: 108468305-108468393 [-]
mdo-mir-92a-1chr7: 108468191-108468268 [-]
Database links

Mature sequence mdo-miR-20a-5p

Accession MIMAT0004169
Sequence

24 - 

uaaagugcuuauagugcagguag

 - 46

Get sequence
Deep sequencing22303 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-20a-3p

Accession MIMAT0026707
Sequence

60 - 

acugcauuaugagcacuugaagu

 - 82

Get sequence
Deep sequencing774 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).