Stem-loop sequence mdo-mir-19a

AccessionMI0005356 (change log)
DescriptionMonodelphis domestica miR-19a stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   g   u  u                 --      ---    ag 
5'  cag cc cuguuaguuuugcauag  uugcac   uaca  a
    ||| || |||||||||||||||||  ||||||   ||||  a
3'  guc gg gguagucaaaacguauc  aacgug   augu  g
   -   c  u                 ua      uug    aa 
Get sequence
Deep sequencing
5824 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 108468609-108468689 [-]
sense
ENSMODT00000028221 ; mdo-mir-19a-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-19a
mdo-mir-17chr7: 108468894-108468978 [-]
mdo-mir-18achr7: 108468760-108468831 [-]
mdo-mir-19achr7: 108468609-108468689 [-]
mdo-mir-20achr7: 108468430-108468531 [-]
mdo-mir-19b-1chr7: 108468305-108468393 [-]
mdo-mir-92a-1chr7: 108468191-108468268 [-]
Database links

Mature sequence mdo-miR-19a-5p

Accession MIMAT0026706
Sequence

14 - 

aguuuugcauaguugcacuac

 - 34

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-19a-3p

Accession MIMAT0004168
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing5819 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).