Stem-loop sequence mdo-mir-18a

AccessionMI0005355 (change log)
DescriptionMonodelphis domestica miR-18a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   u    cu    u   uc   u    a   -  aa u 
5'  uguu  aagg gca  uag gcag uag ug  g a
    ||||  |||| |||  ||| |||| ||| ||  | g
3'  acgg  uucc cgu  auc cguc auc ac  u a
   -    uc    u   ga   c    -   u  ga u 
Get sequence
Deep sequencing
4471 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 108468760-108468831 [-]
sense
ENSMODT00000028266 ; mdo-mir-18a-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-18a
mdo-mir-17chr7: 108468894-108468978 [-]
mdo-mir-18achr7: 108468760-108468831 [-]
mdo-mir-19achr7: 108468609-108468689 [-]
mdo-mir-20achr7: 108468430-108468531 [-]
mdo-mir-19b-1chr7: 108468305-108468393 [-]
mdo-mir-92a-1chr7: 108468191-108468268 [-]
Database links

Mature sequence mdo-miR-18a-5p

Accession MIMAT0004167
Sequence

7 - 

uaaggugcaucuagugcagaua

 - 28

Get sequence
Deep sequencing4371 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-18a-3p

Accession MIMAT0026705
Sequence

48 - 

acugcccuaagugcuccuucuggc

 - 71

Get sequence
Deep sequencing98 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).