Stem-loop sequence mdo-mir-17

AccessionMI0005354 (change log)
DescriptionMonodelphis domestica miR-17 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
       ga       -ca        a  g     g   ugaua 
5' guca  auaaugu   aagugcuu ca ugcag uag     u
   ||||  |||||||   |||||||| || ||||| |||     g
3' cagu  uauuacg   uucacgga gu acguc auc     u
       ga       aug        a  g     -   uaaga 
Get sequence
Deep sequencing
13817 reads, 160 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 108468894-108468978 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-17
mdo-mir-17chr7: 108468894-108468978 [-]
mdo-mir-18achr7: 108468760-108468831 [-]
mdo-mir-19achr7: 108468609-108468689 [-]
mdo-mir-20achr7: 108468430-108468531 [-]
mdo-mir-19b-1chr7: 108468305-108468393 [-]
mdo-mir-92a-1chr7: 108468191-108468268 [-]
Database links

Mature sequence mdo-miR-17-5p

Accession MIMAT0004165
Sequence

14 - 

caaagugcuuacagugcagguagu

 - 37

Get sequence
Deep sequencing12249 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Predicted targets

Mature sequence mdo-miR-17-3p

Accession MIMAT0004166
Sequence

52 - 

acugcagugaaggcacuugua

 - 72

Get sequence
Deep sequencing1559 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Predicted targets

References

1