Stem-loop sequence mdo-mir-29a-1

AccessionMI0005353 (change log)
DescriptionMonodelphis domestica miR-29a-1 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
               uuu       c    ucaa 
5' augacugauuuc   ugguguu agag    u
   ||||||||||||   ||||||| ||||    a
3' uauuggcuaaag   accacga ucuu    u
               uuu       -    uuac 
Get sequence
Deep sequencing
52607 reads, 560 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 190600409-190600472 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-29a-1
mdo-mir-29b-1chr8: 190600820-190600905 [-]
mdo-mir-29a-1chr8: 190600409-190600472 [-]
Database links

Mature sequence mdo-miR-29a-1-5p

Accession MIMAT0026704
Sequence

5 - 

cugauuucuuuugguguucaga

 - 26

Get sequence
Deep sequencing418 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-29a-3p

Accession MIMAT0004164
Sequence

42 - 

uagcaccauuugaaaucgguu

 - 62

Get sequence
Deep sequencing87309 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).