Stem-loop sequence mdo-mir-29b-1

AccessionMI0005352 (change log)
DescriptionMonodelphis domestica miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   gc           -          u      gu      uua   a 
5'   uucuucaggaa gcugguuuca auggug  uuagau   acu c
     ||||||||||| |||||||||| ||||||  ||||||   |||  
3'   aggagguucuu ugacuaaagu uaccac  gaucug   uga u
   --           g          u      --      ---   g 
Get sequence
Deep sequencing
101510 reads, 1.26e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 190600820-190600905 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-29b-1
mdo-mir-29b-1chr8: 190600820-190600905 [-]
mdo-mir-29a-1chr8: 190600409-190600472 [-]
Database links

Mature sequence mdo-miR-29b-1-5p

Accession MIMAT0026703
Sequence

14 - 

gcugguuucauauggugguuuaga

 - 37

Get sequence
Deep sequencing1844 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-29b-3p

Accession MIMAT0004163
Sequence

55 - 

uagcaccauuugaaaucagugu

 - 76

Get sequence
Deep sequencing166470 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).