Stem-loop sequence mdo-mir-221

AccessionMI0005348 (change log)
DescriptionMonodelphis domestica miR-221 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   -  a    -  ug   u         aauu    guuua 
5'  gc ugaa cc  gca acaauguag    cugu     u
    || |||| ||  ||| |||||||||    ||||      
3'  cg acuu gg  cgu uguuacauc    gaca     u
   u  g    u  gu   c         ----    augaa 
Get sequence
Deep sequencing
73165 reads, 840 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 17427280-17427353 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-221
mdo-mir-222achr4: 17426716-17426783 [+]
mdo-mir-221chr4: 17427280-17427353 [+]
Database links

Mature sequence mdo-miR-221-5p

Accession MIMAT0026701
Sequence

7 - 

accuggcauacaauguagaauucugu

 - 32

Get sequence
Deep sequencing37172 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-221-3p

Accession MIMAT0004160
Sequence

47 - 

agcuacauugucugcuggguuuc

 - 69

Get sequence
Deep sequencing35991 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).