Stem-loop sequence mdo-mir-200b

AccessionMI0005345 (change log)
DescriptionMonodelphis domestica miR-200b stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   --------c    -    ug     c      uggug 
5'          cauc uuac  ggcag auugga     u
            |||| ||||  ||||| ||||||     c
3'          guag aaug  ccguc uaaucu     u
   gggguagua    u    gu     a      uugug 
Get sequence
Deep sequencing
40192 reads, 520 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 389166960-389167027 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-200b
mdo-mir-200bchr4: 389166960-389167027 [+]
mdo-mir-200achr4: 389169611-389169696 [+]
mdo-mir-429chr4: 389175425-389175496 [+]
Database links

Mature sequence mdo-miR-200b-5p

Accession MIMAT0026700
Sequence

3 - 

aucuuacugggcagcauugga

 - 23

Get sequence
Deep sequencing3731 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-200b-3p

Accession MIMAT0004156
Sequence

39 - 

uaauacugccugguaaugauga

 - 60

Get sequence
Deep sequencing36461 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).