Stem-loop sequence mdo-mir-181b-1

AccessionMI0005344 (change log)
DescriptionMonodelphis domestica miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   ----aa       aucaa         cug           aa  g 
5'       ggucaca     cauucauug   ucgguggguuu  cu u
         |||||||     |||||||||   |||||||||||  ||  
3'       ccggugu     guaaguaac   agucacucgaa  gg a
   uucacc       -caac         --a           ca  u 
Get sequence
Deep sequencing
209108 reads, 3.14e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 99872867-99872953 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-181b-1
mdo-mir-181a-1chr2: 99873079-99873142 [-]
mdo-mir-181b-1chr2: 99872867-99872953 [-]
Database links

Mature sequence mdo-miR-181b-5p

Accession MIMAT0004155
Sequence

13 - 

aacauucauugcugucggugggu

 - 35

Get sequence
Deep sequencing599624 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-181b-1-3p

Accession MIMAT0026699
Sequence

54 - 

ucacugaacaaugaaugcaac

 - 74

Get sequence
Deep sequencing1147 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).