Stem-loop sequence mdo-mir-181a-1

AccessionMI0005343 (change log)
DescriptionMonodelphis domestica miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   uga   u      cu       a    ggaau 
5'    aca ucaacg  gucggug guuu     u
      ||| ||||||  ||||||| ||||     a
3'    ugu aguugc  cagcuac caaa     a
   cca   u      --       -    aguaa 
Get sequence
Deep sequencing
2298094 reads, 3.88e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 99873079-99873142 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-181a-1
mdo-mir-181a-1chr2: 99873079-99873142 [-]
mdo-mir-181b-1chr2: 99872867-99872953 [-]
Database links

Mature sequence mdo-miR-181a-5p

Accession MIMAT0004154
Sequence

3 - 

aacauucaacgcugucggugagu

 - 25

Get sequence
Deep sequencing6759945 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-181a-1-3p

Accession MIMAT0026698
Sequence

44 - 

ccaucgaccguugauuguacc

 - 64

Get sequence
Deep sequencing44545 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).