Stem-loop sequence mdo-mir-425

AccessionMI0005342 (change log)
DescriptionMonodelphis domestica miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
       u  u     au        cac     u  a  ggaca 
5' aaag gc uugga  gacacgau   ucccg ug gc     g
   |||| || |||||  ||||||||   ||||| || ||     c
3' uuuc cg aaccu  cugugcua   agggc ac cg     c
       u  u     gc        -ua     u  -  aagaa 
Get sequence
Deep sequencing
6135 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 201968551-201968635 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-425
mdo-mir-191chr6: 201970817-201970890 [-]
mdo-mir-425chr6: 201968551-201968635 [-]
mdo-mir-2970chr6: 201968080-201968138 [-]
Database links

Mature sequence mdo-miR-425-5p

Accession MIMAT0026697
Sequence

13 - 

aaugacacgaucacucccguuga

 - 35

Get sequence
Deep sequencing5539 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-425-3p

Accession MIMAT0004153
Sequence

54 - 

aucgggaauaucguguccgucc

 - 75

Get sequence
Deep sequencing595 reads, 5 experiments
Evidence experimental; PCR [1], Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).