Stem-loop sequence mdo-mir-141

AccessionMI0005340 (change log)
DescriptionMonodelphis domestica miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   ug    c     --    u      g    u  u 
5'   gggc aucuu  ccag acagug ugga gg g
     |||| |||||  |||| |||||| |||| || a
3'   cccg uagaa  gguc ugucac aucu uc a
   --    -     au    -      a    -  g 
Get sequence
Deep sequencing
27120 reads, 360 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 108475859-108475922 [+]
antisense
ENSMODT00000023040 ; mdo-mir-141-201; 3'UTR (exon 9)
Clustered miRNAs
< 10kb from mdo-mir-141
mdo-mir-200cchr8: 108475449-108475516 [+]
mdo-mir-141chr8: 108475859-108475922 [+]
Database links

Mature sequence mdo-miR-141-5p

Accession MIMAT0026695
Sequence

8 - 

aucuuccaguacaguggugga

 - 28

Get sequence
Deep sequencing41 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-141-3p

Accession MIMAT0004151
Sequence

41 - 

uaacacugucugguaaagaugc

 - 62

Get sequence
Deep sequencing27077 reads, 5 experiments
Evidence experimental; PCR [1], Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).