Stem-loop sequence mdo-mir-141

Accession MI0005340
Description Monodelphis domestica miR-141 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ug    c     --    u      g    u  u 
  gggc aucuu  ccag acagug ugga gg g
  |||| |||||  |||| |||||| |||| || a
  cccg uagaa  gguc ugucac aucu uc a
--    -     au    -      a    -  g 
Get sequence
Genome context
Coordinates (MonDom5) Overlapping transcripts
chr8: 108475859-108475922 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-141
mdo-mir-200c chr8: 108475449-108475516 [+]
mdo-mir-141 chr8: 108475859-108475922 [+]
Database links

Mature sequence mdo-miR-141

Accession MIMAT0004151
Sequence

41 - 

uaacacugucugguaaagaugc

 - 62

Get sequence
Evidence experimental; PCR [1]
Predicted targets

References

1