Stem-loop sequence mdo-mir-200c

AccessionMI0005339 (change log)
DescriptionMonodelphis domestica miR-200c stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
     -     -      a        u   -ug  g 
5' cc ccauc uuaccc gcaguguu ggg   cc c
   || ||||| |||||| |||||||| |||   || u
3' gg gguag aauggg cgucauaa cuc   gg c
     a     u      c        u   uga  g 
Get sequence
Deep sequencing
43376 reads, 640 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 108475449-108475516 [+]
antisense
ENSMODT00000023040 ; mdo-mir-141-201; 3'UTR (exon 9)
Clustered miRNAs
< 10kb from mdo-mir-200c
mdo-mir-200cchr8: 108475449-108475516 [+]
mdo-mir-141chr8: 108475859-108475922 [+]
Database links

Mature sequence mdo-miR-200c-5p

Accession MIMAT0026694
Sequence

4 - 

caucuuacccagcaguguuugg

 - 25

Get sequence
Deep sequencing22 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-200c-3p

Accession MIMAT0004150
Sequence

44 - 

uaauacugccggguaaugaugg

 - 65

Get sequence
Deep sequencing43354 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).