Stem-loop sequence mdo-mir-96

AccessionMI0005336 (change log)
DescriptionMonodelphis domestica miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   gau    -    gg     u         g     uu      -cu  cu 
5'    gucu gcuu  cccgu uuggcacua cacau  uugcuu   gu  c
      |||| ||||  ||||| ||||||||| |||||  ||||||   ||   
3'    uaga cgaa  gggua aaccgugau gugua  aacgag   cg  u
   --g    a    aa     u         -     cu      ucu  uc 
Get sequence
Deep sequencing
1260 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 189667847-189667943 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-96
mdo-mir-183chr8: 189668265-189668352 [-]
mdo-mir-96chr8: 189667847-189667943 [-]
mdo-mir-182chr8: 189660601-189660671 [-]
Database links

Mature sequence mdo-miR-96

Accession MIMAT0004147
Sequence

19 - 

uuuggcacuagcacauuuuugcu

 - 41

Get sequence
Deep sequencing1259 reads, 4 experiments
Evidence experimental; Microarray [1], PCR [1]
Predicted targets

References

1