Stem-loop sequence mdo-mir-183

AccessionMI0005335 (change log)
DescriptionMonodelphis domestica miR-183 stem-loop
Gene family MIPF0000066; mir-183
Stem-loop
   -a   c        g      --ac     ga        ugaaaa 
5'   cuc uguucugu uauggc    uggua  auucacug      c
     ||| |||||||| ||||||    |||||  ||||||||       
3'   gag acgagaca auaccg    accau  uaagugac      a
   aa   -        a      ggaa     --        uaucac 
Get sequence
Deep sequencing
18738 reads, 180 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 189668265-189668352 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-183
mdo-mir-183chr8: 189668265-189668352 [-]
mdo-mir-96chr8: 189667847-189667943 [-]
mdo-mir-182chr8: 189660601-189660671 [-]
Database links

Mature sequence mdo-miR-183-5p

Accession MIMAT0004146
Sequence

15 - 

uauggcacugguagaauucacug

 - 37

Get sequence
Deep sequencing18725 reads, 5 experiments
Evidence experimental; PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-183-3p

Accession MIMAT0026691
Sequence

55 - 

ugaauuaccaaagggccauaaa

 - 76

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).