Stem-loop sequence mdo-mir-16-1

AccessionMI0005334 (change log)
DescriptionMonodelphis domestica miR-16-1 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -      ag   c          -  a        cguua    uuu 
5'  gucaac  ugc uuagcagcac gu aauauugg     agau   a
    ||||||  ||| |||||||||| || ||||||||     ||||   a
3'  cgguug  aug agucgucgug ca uuaugacc     ucua   a
   c      ga   a          u  a        -----    uga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 318199560-318199649 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-16-1
mdo-mir-15achr4: 318199416-318199498 [+]
mdo-mir-16-1chr4: 318199560-318199649 [+]
Database links

Mature sequence mdo-miR-16-5p

Accession MIMAT0004145
Sequence

14 - 

uagcagcacguaaauauuggcg

 - 35

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-16-1-3p

Accession MIMAT0026690
Sequence

56 - 

ccaguauuaacugugcugcugaa

 - 78

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).