Stem-loop sequence mdo-mir-16-1

AccessionMI0005334 (change log)
DescriptionMonodelphis domestica miR-16-1 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -      ag   c          -  a        cguua    uuu 
5'  gucaac  ugc uuagcagcac gu aauauugg     agau   a
    ||||||  ||| |||||||||| || ||||||||     ||||   a
3'  cgguug  aug agucgucgug ca uuaugacc     ucua   a
   c      ga   a          u  a        -----    uga 
Get sequence
Deep sequencing
25283 reads, 320 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 318199560-318199649 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-16-1
mdo-mir-15achr4: 318199416-318199498 [+]
mdo-mir-16-1chr4: 318199560-318199649 [+]
Database links

Mature sequence mdo-miR-16-5p

Accession MIMAT0004145
Sequence

14 - 

uagcagcacguaaauauuggcg

 - 35

Get sequence
Deep sequencing50391 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-16-1-3p

Accession MIMAT0026690
Sequence

56 - 

ccaguauuaacugugcugcugaa

 - 78

Get sequence
Deep sequencing93 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).