Stem-loop sequence mdo-mir-15a

Accession MI0005333
Description Monodelphis domestica miR-15a stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-15_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-15 microRNA precursor family is made up of small non-coding RNA genes that regulate gene expression. The family includes the related mir-15a and mir-15b sequences, as well as miR-16-1, miR-16-2, miR-195 and miR-497. These six highly conserved miRNAs are clustered on three separate chromosomes. In humans miR-15a and miR-16 are clustered within 0.5 kilobases at chromosome position 13q14. This region has been found to be the most commonly affected in chronic lymphocytic leukaemia (CLL), with deletions of the entire region in more than half of cases. Both miR-15a and miR-16 are thus frequently deleted or down-regulated in CLL samples with 13q14 deletions; occurring in more than two thirds of CLL cases. miR-15a/16-1 deletion has been shown to accelerate the proliferation of both human and mouse B-cells through modulation of the expression of genes controlling cell cycle progression. Studies have found the miR-15a/16-1 microRNA cluster to function as a tumour suppressor, with the oncogene BCL2 as its target. Specifically, miR-15a/16-1 downregulates BCL2 expression and is itself deleted or downregulated in tumour cells. There is a marked increase in BCL2 levels observed in advanced prostate tumour cases, which is inversely correlated with miR-15a/16-1 expression (and so corresponds to a decrease in miR-15a/16-1 levels). Inhibition of cell proliferation by the miR-15a/16-1 cluster occurs in both lymphoid and non-lymphoid tissue. The miR-15a/16-1 cluster has further been found to be highly expressed in CD5+ cells, therefore hinting at an important role of miR-15/16 in normal CD5+ B-cell homeostasis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ggguaaa ua        ua         uggu   g 
ccuug       g  gcagcaca  augguuugu    uuu a
|||||       |  ||||||||  |||||||||    |||  
ggaac       c  cgucgugu  uaccggacg    gga a
     auaaaaa uc        ua         ---u   a 
Get sequence
Genome context
Coordinates (MonDom5) Overlapping transcripts
chr4: 318199416-318199498 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-15a
mdo-mir-15a chr4: 318199416-318199498 [+]
mdo-mir-16 chr4: 318199560-318199649 [+]
Database links

Mature sequence mdo-miR-15a

Accession MIMAT0004144
Sequence

14 - 

uagcagcacauaaugguuuguu

 - 35

Get sequence
Evidence experimental; Microarray [1], PCR [1]
Predicted targets

References

1