Stem-loop sequence mdo-mir-15a

AccessionMI0005333 (change log)
DescriptionMonodelphis domestica miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
        ggguaaa ua        ua         uggu   g 
5' ccuug       g  gcagcaca  augguuugu    uuu a
   |||||       |  ||||||||  |||||||||    |||  
3' ggaac       c  cgucgugu  uaccggacg    gga a
        auaaaaa uc        ua         ---u   a 
Get sequence
Deep sequencing
4678 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 318199416-318199498 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-15a
mdo-mir-15achr4: 318199416-318199498 [+]
mdo-mir-16-1chr4: 318199560-318199649 [+]
Database links

Mature sequence mdo-miR-15a-5p

Accession MIMAT0004144
Sequence

14 - 

uagcagcacauaaugguuuguu

 - 35

Get sequence
Deep sequencing4660 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

Mature sequence mdo-miR-15a-3p

Accession MIMAT0026689
Sequence

51 - 

caggccauauugugcugccuca

 - 72

Get sequence
Deep sequencing16 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).