Stem-loop sequence mdo-mir-449a

AccessionMI0005329 (change log)
DescriptionMonodelphis domestica miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   u ug             -    u          ugacua 
5'  g  augggauggcagu guau guuagcuggu      u
    |  ||||||||||||| |||| ||||||||||      c
3'  c  uacccuaucguca cgua caaucgaccg      u
   a gu             a    -          ugcaag 
Get sequence
Deep sequencing
4364 reads, 140 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 17545606-17545684 [-]
sense
ENSMODT00000024729 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from mdo-mir-449a
mdo-mir-449bchr3: 17545755-17545816 [-]
mdo-mir-449achr3: 17545606-17545684 [-]
mdo-mir-449cchr3: 17544592-17544650 [-]
Database links

Mature sequence mdo-miR-449a-5p

Accession MIMAT0004140
Sequence

11 - 

uggcaguguauuguuagcuggu

 - 32

Get sequence
Deep sequencing4336 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-449a-3p

Accession MIMAT0026685
Sequence

50 - 

cagcuaacaugcaacugcuauc

 - 71

Get sequence
Deep sequencing11 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).