Stem-loop sequence mdo-mir-383

AccessionMI0005328 (change log)
DescriptionMonodelphis domestica miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   ----cuca      aa      u      -   g  a 
5'         gaucag  ggugau guggcu uuc gu g
           ||||||  |||||| |||||| ||| ||  
3'         cugguc  ucacua caccga aag ua a
   gagaaaga      gg      -      c   g  c 
Get sequence
Deep sequencing
1223 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 17427574-17427643 [+]
intergenic
Database links

Mature sequence mdo-miR-383-5p

Accession MIMAT0004139
Sequence

4 - 

agaucagaaggugauuguggcu

 - 25

Get sequence
Deep sequencing1145 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-383-3p

Accession MIMAT0026684
Sequence

45 - 

ccacaucacuggcuggucaga

 - 65

Get sequence
Deep sequencing32 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).