Stem-loop sequence mdo-mir-365

AccessionMI0005326 (change log)
DescriptionMonodelphis domestica miR-365 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   cc      aa        ac           ----   -    uu 
5'   gcaggg  aaugaggg  uuuugggggca    gau gugu  c
     ||||||  ||||||||  |||||||||||    ||| ||||  c
3'   cguucu  uuauuccu  aaaauccccgu    cua caca  a
   ga      cg        -a           aaua   u    uu 
Get sequence
Deep sequencing
906 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 108690913-108690999 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-365
mdo-mir-193bchr6: 108685053-108685111 [+]
mdo-mir-365chr6: 108690913-108690999 [+]
Database links

Mature sequence mdo-miR-365-5p

Accession MIMAT0026683
Sequence

14 - 

gagggacuuuugggggcagaugu

 - 36

Get sequence
Deep sequencing176 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-365-3p

Accession MIMAT0004137
Sequence

55 - 

uaaugccccuaaaaauccuuau

 - 76

Get sequence
Deep sequencing730 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).