Stem-loop sequence mdo-mir-223

AccessionMI0005324 (change log)
DescriptionMonodelphis domestica miR-223 stem-loop
Gene family MIPF0000067; mir-223
Stem-loop
   ucuggcccagauccuuca     a    cc u                ---g   -       
5'                   gugcc cacu  g guauuugacaagcuga    uug gacacu 
                     ||||| ||||  | ||||||||||||||||    ||| ||||| c
3'                   uacgg guga  c cauaaacuguuugacu    gau cugugc 
   ----------gauccguu     a    ac c                guga   g       
Get sequence
Deep sequencing
335 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 10078238-10078348 [-]
intergenic
Database links

Mature sequence mdo-miR-223-5p

Accession MIMAT0026682
Sequence

31 - 

guguauuugacaagcugaguug

 - 52

Get sequence
Deep sequencing32 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-223-3p

Accession MIMAT0004135
Sequence

72 - 

ugucaguuugucaaauacccc

 - 92

Get sequence
Deep sequencing301 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).