Stem-loop sequence mdo-mir-223

Accession

MI0005324 (change log)

Description

Monodelphis domestica miR-223 stem-loop

Gene family

MIPF0000067; mir-223

Stem-loop

   ucuggcccagauccuuca     a    cc u                ---g   -       
5'                   gugcc cacu  g guauuugacaagcuga    uug gacacu 
                     ||||| ||||  | ||||||||||||||||    ||| ||||| c
3'                   uacgg guga  c cauaaacuguuugacu    gau cugugc 
   ----------gauccguu     a    ac c                guga   g       

Deep sequencing

335 reads, 0 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MonDom5; GCF_000002295.2): chrX: 10078238-10078348 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir223
• miRBase Tracker:MI0005324

Mature sequence mdo-miR-223-5p

• Accession: MIMAT0026682
• Sequence: 31 - guguauuugacaagcugaguug - 52
• Deep sequencing: 32 reads, 4 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetScanVert:mdo-miR-223-5p

Mature sequence mdo-miR-223-3p

• Accession: MIMAT0004135
• Sequence: 72 - ugucaguuugucaaauacccc - 92
• Deep sequencing: 301 reads, 5 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetScanVert:mdo-miR-223-3p

References

1. PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).
2. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).