Stem-loop sequence mdo-mir-219-1

AccessionMI0005323 (change log)
DescriptionMonodelphis domestica miR-219-1 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   ca       c     u   u     aa           ------    a 
5'   gggguuc gccgc gau gucca  cgcaauucuug      ugcg g
     ||||||| ||||| ||| |||||  |||||||||||      ||||  
3'   ccucgag cggug cua caggu  guguuaagagc      acgu u
   --       u     u   -     cg           caaccg    c 
Get sequence
Deep sequencing
35027 reads, 400 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 454138610-454138700 [-]
intergenic
Database links

Mature sequence mdo-miR-219-5p

Accession MIMAT0004134
Sequence

16 - 

ugauuguccaaacgcaauucu

 - 36

Get sequence
Deep sequencing13938 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-219-1-3p

Accession MIMAT0026681
Sequence

59 - 

agaauuguggcuggacaucugu

 - 80

Get sequence
Deep sequencing28015 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).