Stem-loop sequence mdo-mir-218-1

AccessionMI0005322 (change log)
DescriptionMonodelphis domestica miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   ---u  uuau  g   a   u      u         cu        gguugugag 
5'     ga    gu gcg gau uucugu gugcuugau  aaccaugu         g
       ||    || ||| ||| |||||| |||||||||  ||||||||          
3'     cu    cg cgc cug aaggua cacgaacug  uugguaca         u
   acau  --uu  a   a   c      c         uc        aaaugagua 
Get sequence
Deep sequencing
9738 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 208287227-208287335 [-]
sense
ENSMODT00000000899 ; SLIT2-201; intron 11
Database links

Mature sequence mdo-miR-218-5p

Accession MIMAT0004133
Sequence

24 - 

uugugcuugaucuaaccaugu

 - 44

Get sequence
Deep sequencing18828 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-218-1-3p

Accession MIMAT0026680
Sequence

67 - 

augguucugucaagcaccaug

 - 87

Get sequence
Deep sequencing303 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).