Stem-loop sequence mdo-mir-214

AccessionMI0005319 (change log)
DescriptionMonodelphis domestica miR-214 stem-loop
Gene family MIPF0000062; mir-214
Stem-loop
   gggcu      acgga           u          aca            aacau 
5'      ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
        ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'      ccgacc     caacaguacac gacggacaga   ggacgacauguc     u
   ----u      -----           u          cac            cacuc 
Get sequence
Deep sequencing
591 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 64368078-64368187 [-]
antisense
ENSMODT00000004978 ; DNM3-201; intron 15
Clustered miRNAs
< 10kb from mdo-mir-214
mdo-mir-199b-2chr2: 64374175-64374233 [-]
mdo-mir-214chr2: 64368078-64368187 [-]
Database links

Mature sequence mdo-miR-214-5p

Accession MIMAT0026679
Sequence

30 - 

ugccugucuacacuugcugugc

 - 51

Get sequence
Deep sequencing193 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-214-3p

Accession MIMAT0004130
Sequence

71 - 

acagcaggcacagacaggcag

 - 91

Get sequence
Deep sequencing396 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).