Stem-loop sequence mdo-mir-206

AccessionMI0005317 (change log)
DescriptionMonodelphis domestica miR-206 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   ------     a                cc     ugaau 
5'       gaggc acaugcuucuuuauau  ccaua     u
         ||||| ||||||||||||||||  |||||     a
3'       cuuug ugugugaaggaaugua  gguau     u
   gaaggg     g                -a     cgucg 
Get sequence
Deep sequencing
118949 reads, 1.9e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 300498999-300499074 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-206
mdo-mir-206chr2: 300498999-300499074 [+]
mdo-mir-133bchr2: 300507722-300507779 [+]
Database links

Mature sequence mdo-miR-206

Accession MIMAT0004128
Sequence

45 - 

uggaauguaaggaagugugug

 - 65

Get sequence
Deep sequencing118948 reads, 5 experiments
Evidence by similarity; MI0000948
Database links
Predicted targets

References

1