Stem-loop sequence mdo-mir-199b-1

AccessionMI0005314 (change log)
DescriptionMonodelphis domestica miR-199b-1 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   -c    cu  -     c       u       u    u   gacu 
5'   ucca  cc gucua ccagugu uagacua cugu cag    c
     ||||  || ||||| ||||||| ||||||| |||| |||     
3'   gggu  gg cggau gguuaca gucugau gaca guu    c
   uc    cg  u     u       c       -    u   auaa 
Get sequence
Deep sequencing
43049 reads, 680 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 453998859-453998947 [-]
antisense
Database links

Mature sequence mdo-miR-199b-1-5p

Accession MIMAT0004125
Sequence

15 - 

cccaguguuuagacuaucuguuc

 - 37

Get sequence
Deep sequencing2519 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-199b-3p

Accession MIMAT0026678
Sequence

54 - 

acaguagucugcacauugguu

 - 74

Get sequence
Deep sequencing110089 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).