Stem-loop sequence mdo-mir-193a

AccessionMI0005312 (change log)
DescriptionMonodelphis domestica miR-193a stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
             u          g  a    ggu 
5' gaggauuggg cuuugugggc ag ugag   g
   |||||||||| |||||||||| || ||||    
3' cucuugaccc gaaacauccg uc acuu   u
             u          g  a    gac 
Get sequence
Deep sequencing
4478 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 504311646-504311711 [-]
intergenic
Database links

Mature sequence mdo-miR-193a-5p

Accession MIMAT0026677
Sequence

7 - 

ugggucuuugugggcgagauga

 - 28

Get sequence
Deep sequencing4404 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-193a-3p

Accession MIMAT0004123
Sequence

41 - 

aacuggccuacaaagucccag

 - 61

Get sequence
Deep sequencing74 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).