Stem-loop sequence mdo-mir-186

AccessionMI0005311 (change log)
DescriptionMonodelphis domestica miR-186 stem-loop
Gene family MIPF0000109; mir-186
Stem-loop
   acc             u     u     uuu   u 
5'    uuccaaagaauuc ccuuu gggcu   gau c
      ||||||||||||| ||||| |||||   ||| u
3'    aggguuuuuuaag ggaaa cccga   uua u
   ---             u     -     -cu   a 
Get sequence
Deep sequencing
22201 reads, 280 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 20448567-20448634 [+]
sense
ENSMODT00000000617 ; ZRANB2-201; intron 7
Database links

Mature sequence mdo-miR-186-5p

Accession MIMAT0004122
Sequence

7 - 

caaagaauucuccuuuugggcuu

 - 29

Get sequence
Deep sequencing21472 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-186-3p

Accession MIMAT0026676
Sequence

47 - 

cccaaaggugaauuuuuuggg

 - 67

Get sequence
Deep sequencing729 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).