Stem-loop sequence mdo-mir-181a-3

AccessionMI0005310 (change log)
DescriptionMonodelphis domestica miR-181a-3 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   ug    aa         cu       a     --ag a 
5'   gggg  cauucaacg  gucggug guuug    c g
     ||||  |||||||||  ||||||| |||||    |  
3'   cccc  gugaguugc  cagcuac caaac    g c
   -g    ag         --       -     ggaa u 
Get sequence
Deep sequencing
2274880 reads, 3.85e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 446461502-446461573 [-]
antisense
ENSMODT00000015282 ; PODNL1-201; intron 11
Clustered miRNAs
< 10kb from mdo-mir-181a-3
mdo-mir-181a-3chr3: 446461502-446461573 [-]
mdo-mir-181b-3chr3: 446461129-446461192 [-]
Database links

Mature sequence mdo-miR-181a-5p

Accession MIMAT0004154
Sequence

7 - 

aacauucaacgcugucggugagu

 - 29

Get sequence
Deep sequencing6759945 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-181a-3-3p

Accession MIMAT0031039
Sequence

49 - 

ccaucgaccguugaguggacc

 - 69

Get sequence
Deep sequencing21334 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).