Stem-loop sequence mdo-mir-187

AccessionMI0005309 (change log)
DescriptionMonodelphis domestica miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   au    aga         a                a c  u 
5'   ugug   ccucuggcu caacacaggacacggg g uu u
     ||||   ||||||||| |||||||||||||||| | ||  
3'   acac   ggagaccga guuguguucugugcuc c ag c
   --    -gg         c                c a  u 
Get sequence
Deep sequencing
26014 reads, 340 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 87606200-87606280 [+]
intergenic
Database links

Mature sequence mdo-miR-187-5p

Accession MIMAT0026674
Sequence

14 - 

uggcuacaacacaggacacggga

 - 36

Get sequence
Deep sequencing6711 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-187-3p

Accession MIMAT0004120
Sequence

51 - 

ucgugucuuguguugcagcc

 - 70

Get sequence
Deep sequencing19302 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).