Stem-loop sequence mdo-mir-184

AccessionMI0005308 (change log)
DescriptionMonodelphis domestica miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   c       auc         c      a c     uuucua 
5'  cagucac   cccuuauca uuuucc g ccagc      a
    |||||||   ||||||||| |||||| | |||||      u
3'  guuagug   gggaauagu aagagg c gguug      g
   a       gau         c      - a     uuaauc 
Get sequence
Deep sequencing
669038 reads, 9.6e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 120539101-120539184 [-]
intergenic
Database links

Mature sequence mdo-miR-184-5p

Accession MIMAT0026673
Sequence

13 - 

ccuuaucacuuuuccagcccagc

 - 35

Get sequence
Deep sequencing22 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-184-3p

Accession MIMAT0004119
Sequence

53 - 

uggacggagaacugauaagggu

 - 74

Get sequence
Deep sequencing669016 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).