Stem-loop sequence mdo-mir-182

AccessionMI0005307 (change log)
DescriptionMonodelphis domestica miR-182 stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
   gcugugu       u -g      uca      ugagau 
5'        uuggcaa g  uagaac   cacugg      a
          ||||||| |  ||||||   ||||||       
3'        aaccguu c  aucuug   guggcc      a
   ----auc       - ag      ---      uaaggu 
Get sequence
Deep sequencing
37010 reads, 340 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 189660601-189660671 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-182
mdo-mir-183chr8: 189668265-189668352 [-]
mdo-mir-96chr8: 189667847-189667943 [-]
mdo-mir-182chr8: 189660601-189660671 [-]
Database links

Mature sequence mdo-miR-182-5p

Accession MIMAT0004118
Sequence

7 - 

uuuggcaaugguagaacucaca

 - 28

Get sequence
Deep sequencing37008 reads, 5 experiments
Evidence experimental; PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-182-3p

Accession MIMAT0026672
Sequence

50 - 

gugguucuagacuugccaacua

 - 71

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).