Stem-loop sequence mdo-mir-145

AccessionMI0005305 (change log)
DescriptionMonodelphis domestica miR-145 stem-loop
Gene family MIPF0000079; mir-145
Stem-loop
          uc    u  c            uagau 
5' cucaggg  cagu uu ccaggaaucccu     g
   |||||||  |||| || ||||||||||||     c
3' gaguucu  guca aa gguccuuagggg     u
          -u    u  a            uagaa 
Get sequence
Deep sequencing
14550 reads, 100 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 377173845-377173914 [-]
antisense
ENSMODT00000007343 ; IL17B-201; intron 1
Clustered miRNAs
< 10kb from mdo-mir-145
mdo-mir-143chr1: 377176751-377176813 [-]
mdo-mir-145chr1: 377173845-377173914 [-]
Database links

Mature sequence mdo-miR-145-5p

Accession MIMAT0004116
Sequence

7 - 

guccaguuuucccaggaaucccu

 - 29

Get sequence
Deep sequencing7949 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

Mature sequence mdo-miR-145-3p

Accession MIMAT0026670
Sequence

47 - 

auuccuggaaauacuguucu

 - 66

Get sequence
Deep sequencing6581 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).