Stem-loop sequence mdo-mir-144

AccessionMI0005303 (change log)
DescriptionMonodelphis domestica miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   c  -     ag     g        g         -a    gc 
5'  gg ggccc  gccgg auaucauc uauacugua  guuu  a
    || |||||  ||||| |||||||| |||||||||  ||||   
3'  cc ccggg  cgguc uguaguag auaugacau  caga  a
   u  g     ag     a        -         ca    gu 
Get sequence
Deep sequencing
60096 reads, 660 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 506777490-506777574 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-144
mdo-mir-144chr2: 506777490-506777574 [-]
mdo-mir-451chr2: 506777375-506777436 [-]
Database links

Mature sequence mdo-miR-144-5p

Accession MIMAT0026669
Sequence

15 - 

ggauaucaucguauacuguaagu

 - 37

Get sequence
Deep sequencing59294 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-144-3p

Accession MIMAT0004114
Sequence

52 - 

uacaguauagaugauguacugg

 - 73

Get sequence
Deep sequencing801 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).