Stem-loop sequence mdo-mir-143

AccessionMI0005302 (change log)
DescriptionMonodelphis domestica miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
         g         g      u  -   g 
5' cccgag ugcagugcu caucuc gg uca u
   |||||| ||||||||| |||||| || |||  
3' gggcuc augucacga guagag cu agu u
         g         a      u  g   g 
Get sequence
Deep sequencing
4012609 reads, 7.95e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 377176751-377176813 [-]
antisense
ENSMODT00000007343 ; IL17B-201; intron 1
Clustered miRNAs
< 10kb from mdo-mir-143
mdo-mir-143chr1: 377176751-377176813 [-]
mdo-mir-145chr1: 377173845-377173914 [-]
Database links

Mature sequence mdo-miR-143-5p

Accession MIMAT0026668
Sequence

7 - 

gugcagugcugcaucucugg

 - 26

Get sequence
Deep sequencing2043 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-143-3p

Accession MIMAT0004113
Sequence

40 - 

ugagaugaagcacuguagcucg

 - 61

Get sequence
Deep sequencing4010565 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).