Stem-loop sequence mdo-mir-135b

AccessionMI0005298 (change log)
DescriptionMonodelphis domestica miR-135b stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   ---a       ----g                  cau          -   cu 
5'     gcucucu     cuguggccuauggcuuuu   uccuauguga uug  g
       |||||||     ||||||||||||||||||   |||||||||| |||  u
3'     cgagagg     gacaucggguaccgaaaa   gggauguacu aac  u
   ccuc       ggagg                  -uc          c   cc 
Get sequence
Deep sequencing
5526 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 111348471-111348570 [-]
intergenic
Database links

Mature sequence mdo-miR-135b-5p

Accession MIMAT0004109
Sequence

18 - 

uauggcuuuucauuccuaugug

 - 39

Get sequence
Deep sequencing5406 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-135b-3p

Accession MIMAT0026667
Sequence

57 - 

auguagggcuaaaagccauggg

 - 78

Get sequence
Deep sequencing120 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).