Stem-loop sequence mdo-mir-135a

AccessionMI0005297 (change log)
DescriptionMonodelphis domestica miR-135a stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   a    aa     ucua    c           u            u g a 
5'  gaua  uucac    gugu uuauggcuuuu auuccuauguga a u a
    ||||  |||||    |||| ||||||||||| |||||||||||| | | u
3'  cugu  aagug    caua aguaccgaagg uagggauguacu u a a
   a    -a     -uua    a           -            c g a 
Get sequence
Deep sequencing
6983 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 74872640-74872739 [+]
intergenic
Database links

Mature sequence mdo-miR-135a-5p

Accession MIMAT0004108
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing5951 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-135a-3p

Accession MIMAT0026666
Sequence

61 - 

auguagggauggaagccaugaa

 - 82

Get sequence
Deep sequencing1032 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).