Stem-loop sequence mdo-mir-133a-1

AccessionMI0005296 (change log)
DescriptionMonodelphis domestica miR-133a-1 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   -      uuu    a       aa  u  a        accua 
5'  caaugc   gcua agcuggu  aa gg accaaauc     u
    ||||||   |||| |||||||  || || ||||||||      
3'  guuacg   cgau ucgacca  uu cc ugguuuag     u
   a      uau    g       ac  c  c        guaac 
Get sequence
Deep sequencing
21711 reads, 140 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 263368065-263368151 [+]
antisense
ENSMODT00000027331 ; MIB1-201; intron 12
Clustered miRNAs
< 10kb from mdo-mir-133a-1
mdo-mir-1-1chr3: 263364374-263364459 [+]
mdo-mir-133a-1chr3: 263368065-263368151 [+]
Database links

Mature sequence mdo-miR-133a-1-5p

Accession MIMAT0026665
Sequence

15 - 

agcugguaaaauggaaccaaau

 - 36

Get sequence
Deep sequencing2752 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-133a-3p

Accession MIMAT0004107
Sequence

53 - 

uugguccccuucaaccagcugu

 - 74

Get sequence
Deep sequencing34219 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).