Stem-loop sequence mdo-mir-130a

AccessionMI0005295 (change log)
DescriptionMonodelphis domestica miR-130a stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   u      a        c      ug  a   ucugca 
5'  ggccag gcucuuuu acauug  cu cug      c
    |||||| |||||||| ||||||  || |||       
3'  ucgguu cgggaaaa uguaac  ga gau      c
   g      a        a      gu  c   cacuau 
Get sequence
Deep sequencing
20179 reads, 160 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr5: 291845601-291845676 [+]
intergenic
Database links

Mature sequence mdo-miR-130a-5p

Accession MIMAT0026664
Sequence

9 - 

gcucuuuucacauugugcuacu

 - 30

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-130a-3p

Accession MIMAT0004106
Sequence

49 - 

cagugcaauguaaaaagggcau

 - 70

Get sequence
Deep sequencing20167 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).