Stem-loop sequence mdo-mir-129

AccessionMI0005294 (change log)
DescriptionMonodelphis domestica miR-129 stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
        -       c   cu      g   -  c  ua 
5' uggau cuuuuug ggu  gggcuu cug uu cu  a
   ||||| ||||||| |||  |||||| ||| || ||   
3' aucua gaaaaac cca  cccgaa gac ga ga  a
        u       c   uu      g   u  u  cu 
Get sequence
Deep sequencing
255595 reads, 4.08e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 188064158-188064231 [+]
intergenic
Database links

Mature sequence mdo-miR-129-5p

Accession MIMAT0004105
Sequence

6 - 

cuuuuugcggucugggcuugcu

 - 27

Get sequence
Deep sequencing236084 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Predicted targets

Mature sequence mdo-miR-129-3p

Accession MIMAT0026663
Sequence

50 - 

aagcccuuaccccaaaaagua

 - 70

Get sequence
Deep sequencing19496 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).