Stem-loop sequence mdo-mir-128a

AccessionMI0005293 (change log)
Previous IDsmdo-mir-128b
DescriptionMonodelphis domestica miR-128a stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   ugu        a          uua      ca    g gag 
5'    gcagcagg aggggggccg   cacugu  gaga u   u
      |||||||| ||||||||||   ||||||  |||| |    
3'    ugucgucc uuucucuggc   gugaca  cucu g   a
   cgg        c          caa      --    g acg 
Get sequence
Deep sequencing
227165 reads, 3.1e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 290241098-290241181 [-]
sense
ENSMODT00000002871 ; ARPP21-201; intron 19
Database links

Mature sequence mdo-miR-128a-5p

Accession MIMAT0026662
Sequence

15 - 

gggggccguuacacugucagaga

 - 37

Get sequence
Deep sequencing2845 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-128a-3p

Accession MIMAT0004104
Previous IDsmdo-miR-128b
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Deep sequencing224320 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).