Stem-loop sequence mdo-mir-125b-2

AccessionMI0005292 (change log)
DescriptionMonodelphis domestica miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   aa    u    c           au     c 
5'   uccc gaga ccuaacuugug  guuua c
     |||| |||| |||||||||||  ||||| g
3'   aggg uucu ggauugggcac  uaaau u
   cg    -    c           -c     u 
Get sequence
Deep sequencing
164742 reads, 2.3e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 226229991-226230053 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-125b-2
mdo-mir-12349chr4: 226228925-226228981 [+]
mdo-mir-125b-2chr4: 226229991-226230053 [+]
Database links

Mature sequence mdo-miR-125b-5p

Accession MIMAT0004103
Sequence

3 - 

ucccugagacccuaacuuguga

 - 24

Get sequence
Deep sequencing326509 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-125b-2-3p

Accession MIMAT0031106
Sequence

43 - 

acggguuaggcucuugggagc

 - 63

Get sequence
Deep sequencing1471 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).