Stem-loop sequence mdo-mir-125b-1

AccessionMI0005291 (change log)
DescriptionMonodelphis domestica miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   a   uu     uc  ug   c   a       ----ag   u 
5'  cuu  ccuag  cc  aga ccu acuugug      gcu u
    |||  |||||  ||  ||| ||| |||||||      |||  
3'  gag  ggauc  gg  ucu gga uggacac      cga u
   g   gc     ca  gu   c   c       caacag   c 
Get sequence
Deep sequencing
163392 reads, 2.3e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 1003541-1003622 [+]
intergenic
Database links

Mature sequence mdo-miR-125b-5p

Accession MIMAT0004103
Sequence

12 - 

ucccugagacccuaacuuguga

 - 33

Get sequence
Deep sequencing326509 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-125b-1-3p

Accession MIMAT0026661
Sequence

52 - 

acaggucaggcucuugggaccu

 - 73

Get sequence
Deep sequencing154 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).