Stem-loop sequence mdo-mir-124a-3

AccessionMI0005290 (change log)
DescriptionMonodelphis domestica miR-124a-3 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
       - c        a   ga        uaaug 
5' cucu g guguucac gcg  ccuugauu     u
   |||| | |||||||| |||  ||||||||      
3' gaga c cguaagug cgc  ggaauuaa     c
       a -        g   ac        cauau 
Get sequence
Deep sequencing
186340 reads, 2.78e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 474834580-474834647 [-]
intergenic
Database links

Mature sequence mdo-miR-124a-5p

Accession MIMAT0026660
Sequence

7 - 

guguucacagcggaccuugau

 - 27

Get sequence
Deep sequencing7313 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-124a-3p

Accession MIMAT0004102
Sequence

43 - 

uuaaggcacgcggugaaugcca

 - 64

Get sequence
Deep sequencing551664 reads, 4 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).