Stem-loop sequence mdo-mir-124a-2

AccessionMI0005289 (change log)
DescriptionMonodelphis domestica miR-124a-2 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   -a    a a     u    cc        a   ga        uaau 
5'   ucag g cucug cucu  guguucac gcg  ccuugauu    g
     |||| | ||||| ||||  |||||||| |||  ||||||||    u
3'   aguc c gaggc gaga  cguaagug cgc  ggaauuaa    c
   aa    - -     -    ac        g   ac        caua 
Get sequence
Deep sequencing
186313 reads, 2.78e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 173742224-173742316 [-]
intergenic
Database links

Mature sequence mdo-miR-124a-5p

Accession MIMAT0026660
Sequence

21 - 

guguucacagcggaccuugau

 - 41

Get sequence
Deep sequencing7313 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-124a-3p

Accession MIMAT0004102
Sequence

56 - 

uuaaggcacgcggugaaugcca

 - 77

Get sequence
Deep sequencing551664 reads, 4 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).