Stem-loop sequence mdo-mir-124a-1

AccessionMI0005288 (change log)
DescriptionMonodelphis domestica miR-124a-1 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   a      uc   cc        a   ga        uaaau 
5'  ggccuc  ucu  guguucac gcg  ccuugauu     g
    ||||||  |||  |||||||| |||  ||||||||     u
3'  ucgggg  aga  cguaagug cgc  ggaauuaa     c
   g      ua   ac        g   ac        cauac 
Get sequence
Deep sequencing
186335 reads, 2.78e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 587846264-587846348 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-124a-1
mdo-mir-7258chr1: 587845369-587845435 [+]
mdo-mir-124a-1chr1: 587846264-587846348 [+]
Database links

Mature sequence mdo-miR-124a-5p

Accession MIMAT0026660
Sequence

15 - 

guguucacagcggaccuugau

 - 35

Get sequence
Deep sequencing7313 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-124a-3p

Accession MIMAT0004102
Sequence

52 - 

uuaaggcacgcggugaaugcca

 - 73

Get sequence
Deep sequencing551664 reads, 4 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).