Stem-loop sequence mdo-mir-122

AccessionMI0005287 (change log)
Previous IDsmdo-mir-122a
DescriptionMonodelphis domestica miR-122 stem-loop
Gene family MIPF0000095; mir-122
Stem-loop
   -   -      gg       c           ugucc 
5'  cag agcuau  aguguga aaugguguuug     a
    ||| ||||||  ||||||| |||||||||||      
3'  guc ucgaua  ucacacu uuaccgcaaac     g
   u   a      aa       a           uaucu 
Get sequence
Deep sequencing
1190 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 247368064-247368137 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-122
mdo-mir-122bchr3: 247368074-247368131 [+]
mdo-mir-122chr3: 247368064-247368137 [-]
Database links

Mature sequence mdo-miR-122-5p

Accession MIMAT0004101
Previous IDsmdo-miR-122a
Sequence

9 - 

uggagugugacaaugguguuugugu

 - 33

Get sequence
Deep sequencing1189 reads, 5 experiments
Evidence experimental; PCR [1], Illumina [2]
Predicted targets

Mature sequence mdo-miR-122-3p

Accession MIMAT0026659
Sequence

46 - 

acgccauuaucacacuaaaua

 - 66

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).